Skip to main content

Table 1 Primers used for reverse transcription, PCR and sequencing. Primer names generally indicate approximate binding positions in the NoVs genome

From: Identification of two divergent swine Noroviruses detected at the slaughterhouse in North East Italy

PrimerSequence (5′-3′)Genome Position (nt)Amplicon size
NORP7FGAAGATGGCGTCTAACGACG7–27539 bp
NORP_546RTGAGGGACATGCACCACTC527–546
NORP_374FGAACCACTCCCAGGCTCTAT374–394876 bp
NORP_1250RCCTCCATGTCTAGAACAGCA1230–1250
NORP1085FCGCATGTTCACTTCAGCAGC1085–1105951 bp
NORP2036RCCCTTYCCATAAGGGGTGTT2016–2036
NORP3127FCTTTTGATYACCACCACTCATGT3127–31501191 bp
NORP4318RTCTGTTGGGTGGAGTCCCA4299–4318
NORP3819FGAAACCATAGTGAATTTTCTAG3819–3841540 bp
NORP4359RCAGCAGAGAATTTCACCATG4339–4359
NORP4051FTGAARGATGARCTTGTSAAGAC4051–40731087 bp
NORP5138RTTGACCTCTGGTACGAGACC5118–5138
NVG4FTGGATGCGRTTCTCNGACYT5007–50271821 bp
NORP5647FCGAACAATGCTGGGGATGATGTTT5647–5671
NORP6828RTGATTAAKKGCATTRGYACCAGCA6804–6828
NORP6579FCACCACAGGTAGAGTGCTC6579–65981071 bp
NORP7650RTTTTTTTGGAGATCAGGGAACAG7627–7650